View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12194_low_28 (Length: 312)
Name: NF12194_low_28
Description: NF12194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12194_low_28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 103 - 312
Target Start/End: Original strand, 37323164 - 37323372
Alignment:
| Q |
103 |
aacttagtccaaactcatgcccagatctgaccccgacgacatcattgtcttcacgtgtgtagtgttgaaattgattgcatcatctcccctttaaaaaatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323164 |
aacttagtccaaactcatgcccagatccgacct-gacgacatcattgtcttcacgtgtgtagtgttgaaattgattgcatcatctcccctttaaaaaatt |
37323262 |
T |
|
| Q |
203 |
ggatatctctttggggcaagccccaagagcccttcccccaatatataaatacttatgttgcgggaagtatctccaatgtggaacttgtcgaaatttttta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37323263 |
ggatatctctttggggcaagccccaagagcccttcctccaatatataaatacttgtgttgtgagaagtatctccaatgtgggacttgtcgaaatttttta |
37323362 |
T |
|
| Q |
303 |
attcacacac |
312 |
Q |
| |
|
|||||||||| |
|
|
| T |
37323363 |
attcacacac |
37323372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University