View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12194_low_30 (Length: 301)
Name: NF12194_low_30
Description: NF12194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12194_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 17 - 297
Target Start/End: Complemental strand, 52771129 - 52770849
Alignment:
| Q |
17 |
cagcagcatcaaatgctaccggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52771129 |
cagcagcatcaaatgctaccggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaa |
52771030 |
T |
 |
| Q |
117 |
ctcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52771029 |
ctcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttct |
52770930 |
T |
 |
| Q |
217 |
gttgctgaagctttagggactggtcctactttcttgattcttgctgtaataaccgtgcttgcctttttatctctgcttctc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
52770929 |
gttgctgaagctttagggactggtcctactttcttgattcttgctgtaataaccgtgcttgcctttttatttgtgcttctc |
52770849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 37 - 261
Target Start/End: Complemental strand, 52767145 - 52766921
Alignment:
| Q |
37 |
ggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaactcagagatatatcctaaag |
136 |
Q |
| |
|
||||||||||| ||| | |||||| || ||||| || |||||||| || |||||||| || |||||||||||| | ||||| || ||||||| | | |
|
|
| T |
52767145 |
ggatggcttgcggttgttggtttggccctatatattgcatttttctcgccagggatggggcctgtgccgtgggcagtaaactctgaagtatatccgcagg |
52767046 |
T |
 |
| Q |
137 |
aatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttctgttgctgaagctttagggac |
236 |
Q |
| |
|
| || ||||||| ||||| || ||||||||||||||| |||| |||| ||| | |||||| ||||| |||||||||| |||| |||||| |||||| |
|
|
| T |
52767045 |
agtaccgaggaatgtgtggagggatgtcagctactgtgaattggatttcaaatttgattgtggctcagtcatttctttccattgcagaagctgcagggac |
52766946 |
T |
 |
| Q |
237 |
tggtcctactttcttgattcttgct |
261 |
Q |
| |
|
||||||||| |||||| |||||||| |
|
|
| T |
52766945 |
tggtcctacattcttgcttcttgct |
52766921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 115 - 263
Target Start/End: Original strand, 392778 - 392926
Alignment:
| Q |
115 |
aactcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttcttt |
214 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| || ||||| || ||| |||| || ||||||||| |||| ||| | || ||||| ||| ||||||| |
|
|
| T |
392778 |
aactcagagatatatcctgaagaatatcgaggtatatgtgggggcatggcagcgaccgtgtgttggatttcaaatttgatcgtgtccgagagctttcttt |
392877 |
T |
 |
| Q |
215 |
ctgttgctgaagctttagggactggtcctactttcttgattcttgctgt |
263 |
Q |
| |
|
| ||||||| ||| | |||| || | | |||||||||||| ||||||| |
|
|
| T |
392878 |
cgattgctgacgctatcgggattgcttcaactttcttgattattgctgt |
392926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University