View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12195_high_2 (Length: 462)
Name: NF12195_high_2
Description: NF12195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12195_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 12 - 379
Target Start/End: Complemental strand, 4175813 - 4175446
Alignment:
| Q |
12 |
aacctgtgccgtctcatcggaaaactcgccgccgggaagaaattccgacggatctgaattggtcggaatatcttcgttttgttgttgttggtgagttgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175813 |
aacctgtgccgtctcatcggaaaactcgccgccgggaagaaattccgacggatctgaattggtcggaatatcttcgttttgttgttgttggtgagttgat |
4175714 |
T |
 |
| Q |
112 |
tcacccgaggtacgacgtttgaaaagaagtaattccttaagagctttccatgattttcgatctttaacaacgttgtnnnnnnnnnnnnnnnnnnnnttgg |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4175713 |
tcatccgaggtacgacgtttgaaaagaagtaattccttaaaagctttccatgattttcgatctttaacaacgttgttgttgctgctgctgctgctgttgg |
4175614 |
T |
 |
| Q |
212 |
taacactaacattaacaacaacgttgtttggttcgttttctcgtataatatctaagagtgtttggtttgtgnnnnnnnggttggataaaacggcatcgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
4175613 |
taacactaacattaacaacaacgttgtttggttcgttttctcgtataatatctaagagtgtttggtttgtgtttttttggttggataaaacggcgtcgtt |
4175514 |
T |
 |
| Q |
312 |
ttggattaaactagctagtgagctacgagtgttgcttgtggatgtcatttgatcgtaaagtgttattc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4175513 |
ttggattaaactagctagtgagctacgagtgttgctcgtggatgtcatttgatcgtaaagtgttattc |
4175446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University