View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12195_high_7 (Length: 263)
Name: NF12195_high_7
Description: NF12195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12195_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 20688351 - 20688122
Alignment:
| Q |
19 |
cacagaacttaattggaaatggttcaacatcatcttctttgaattctttcttcaatagtaagggtccaatacctcttctttctcctctagtggtgcttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20688351 |
cacagaacttaattggaaatggttcaacatcatcttctttgaattctttcttcaatagtaagggtccaatacctcttctttctcctctagtggtgcttga |
20688252 |
T |
 |
| Q |
119 |
atccacttccatcagagaagaaaaccccgcaaaatctcattgatattgtttttatttttgcatgttccatgg--ttttcttatcttgtgtcttaatttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| | ||||||||||| |||| ||||||||||||||||| ||| |
|
|
| T |
20688251 |
atccacttccatcagagaagaaaaccctgcaaaatctcattgatattgttgttattttagtatgttccatggtttttttttatcttgtgtcttaatgtct |
20688152 |
T |
 |
| Q |
217 |
tgtaaacttgttgtgcactacaccataagt |
246 |
Q |
| |
|
||| ||| |||||||||||||||||||||| |
|
|
| T |
20688151 |
tgttaacctgttgtgcactacaccataagt |
20688122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University