View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12195_low_6 (Length: 268)

Name: NF12195_low_6
Description: NF12195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12195_low_6
NF12195_low_6
[»] chr1 (1 HSPs)
chr1 (131-257)||(49401095-49401221)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 131 - 257
Target Start/End: Original strand, 49401095 - 49401221
Alignment:
131 tatgggtttacaaagccagctaaacgacgtgtcgtctgattcaattcctttacttgttctgatgcacatagccacctgcgtcaattacatccgttcgatg 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49401095 tatgggtttacaaagccagctaaacgacgtgtcgtctgattcaattcctttacttgttctgatgcacatagccacctgcgtcaattacatccgttcgatg 49401194  T
231 cttctcaatttcctccaatccacaggt 257  Q
    |||||||||||||||||||||| ||||    
49401195 cttctcaatttcctccaatccataggt 49401221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University