View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12196_high_5 (Length: 472)
Name: NF12196_high_5
Description: NF12196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12196_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 16 - 466
Target Start/End: Original strand, 50234936 - 50235386
Alignment:
| Q |
16 |
cacaattgcctacactttcaaccgctccaggtttagccgctaaaatctacgtgtcacttattaatgaaggtgaaatggcatttagttctgctgttgaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50234936 |
cacaattgcctacactttcaaccgctccaggtttagccgctaaaatctacgtgtcacttattaatgaaggtgaaatggcatttagttctgctgttgaagg |
50235035 |
T |
 |
| Q |
116 |
ctcaaccttcgatgccacgcttgttcaaagcactgaggctgaaccaggcgttgtttcaattctccaggtttcacagccaattgttaaggttggtgcttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235036 |
ctcaaccttcgatgccacgcttgttcaaagcactgaggctgaaccaggcgttgtttcaattctccaggtttcacagccaattgttaaggttggtgcttca |
50235135 |
T |
 |
| Q |
216 |
gctccggcaactccagcaacactatcaaaaccagcaacacctgcagctgtgtcaacatccagtgccggtgaggttgcaacaccagcagctgtgccaacat |
315 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50235136 |
gctccagcaactccagcaacactatcaaaaccagcaacacctgcagctgtgtcaacatccagtgccggtgaggttgcaacaccagcagctgtgccagcat |
50235235 |
T |
 |
| Q |
316 |
ccggtgccggtcaggttacaacaccagcagcatcaccttctgtggtgattgctgagtcacctgagagttttggtgatgcacctgctcctgctcctagtgc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235236 |
ccggtgccggtcaggttacaacaccagcagcatcaccttctgtggtgattgctgagtcacctgagagttttggtgatgcacctgctcctgctcctagtgc |
50235335 |
T |
 |
| Q |
416 |
ctcttctcgtgccacattcagattcattggtgctgttattgcctttgcttc |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235336 |
ctcttctcgtgccacattcagattcattggtgctgttattgcctttgcttc |
50235386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University