View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12196_low_15 (Length: 281)
Name: NF12196_low_15
Description: NF12196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12196_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 109 - 273
Target Start/End: Original strand, 45364498 - 45364662
Alignment:
| Q |
109 |
taccttttcaattatcagtcctttactggaagaagaccttccaaacttcgaaggtgaaggttcagagtatcgctccaccgttttcctttccctagttggc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45364498 |
taccttttcaattatcagtcctttactggaagaagaccttccaaacttcgaaggtgaaggttcagagtaccgctccaccgttttcctttccctagttggc |
45364597 |
T |
 |
| Q |
209 |
ctatcactcgtcggagtaaccggactcttcttctccgacgactctttcttcacacccttcttctc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45364598 |
ctatcactcgtcggagtaaccggactcttcttctccgacgactctttcttcacacccttcttctc |
45364662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University