View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12197_high_10 (Length: 228)
Name: NF12197_high_10
Description: NF12197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12197_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 29248748 - 29248946
Alignment:
| Q |
16 |
agtggtcaccgccgagatatgaggagcttcacagagaagaaaaaatcgttgtggcggtgacagaagtagagaagtactccctccccagctgtgttaagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29248748 |
agtggtcaccgccgagatatgaggagcttcacagagaagaaaaaatcgttgtggcggtgagagaagtagagaagtactccctccccagctgtgttaagtt |
29248847 |
T |
 |
| Q |
116 |
gacatctctatacacatgccaaactactttttataagtcaaattagtacaccgaaattggcactaggaaaaatcgaactaagacctgaagaggagcaca |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29248848 |
gacatctctatacacatgccaaaccactttttttaagtcaaattagtacaccgaaattgacactaggaaaaatcgaaataagacctgaagaggagcaca |
29248946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University