View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12197_high_9 (Length: 239)
Name: NF12197_high_9
Description: NF12197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12197_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 220
Target Start/End: Original strand, 44103358 - 44103577
Alignment:
| Q |
2 |
caacgataaagaaatgatcgagaatgaaaggttagatgagaaagagtaatacaaaccctagcagagcgatgaagaaagagactatcgatgaagctatgga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44103358 |
caacgataaagaaatgatcgagaatgaaaggttagatgagaaagaataatacaaaccctagcagagcgatgaagaaagagactatcgatgaagctatgga |
44103457 |
T |
 |
| Q |
102 |
ctcgaaagcgaaagggttttgaagaatggcggtgaaagttcgtttggttc-tttctctctattttctactcgtggctcgttttggttgggttagtcagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44103458 |
ctcgaaagcgaaagggttttgaagaatggcggtgaaagttcgtttggttcttttctctctattttctactcgtggctcgttttggttgggtaagtcagat |
44103557 |
T |
 |
| Q |
201 |
atatatatggtggactcgac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44103558 |
atatatatggtggactcgac |
44103577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University