View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12197_low_8 (Length: 259)
Name: NF12197_low_8
Description: NF12197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12197_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 82 - 256
Target Start/End: Complemental strand, 27959764 - 27959588
Alignment:
| Q |
82 |
tattattgatgtaaatagagtataacgaatcatcatgtatatattatatatgatcatatacaatttcaagtggcagcaaaaggcttaatcaattataa-- |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27959764 |
tattattgatgtaaagagagtataacgaatcatcatgtatatat---------------acaatttcaagtggcagcaaaaggcttaatcaattataaaa |
27959680 |
T |
 |
| Q |
180 |
--ctct---------tctatcataggaagttaggaacatctatctat----aatgtacttgtatctttgttgcacctttgtttagtgttctt |
256 |
Q |
| |
|
|| | ||||||||||||| | |||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
27959679 |
tactataattatacgtctatcataggaaatcaggaacatctatctatctataatgtacttgtatctttgttgcatctttgtttagtgctctt |
27959588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 61
Target Start/End: Complemental strand, 27959937 - 27959898
Alignment:
| Q |
22 |
gcatatatcacatgggtctggtttagtgtttcatgaagat |
61 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27959937 |
gcatatatcatatgggtctggtttagtgtttcatgaagat |
27959898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University