View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12198_low_1 (Length: 228)
Name: NF12198_low_1
Description: NF12198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12198_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 39185319 - 39185439
Alignment:
| Q |
100 |
agcaatagcagcaagtctcagagacccaacagaacgatataaaccccaatcctaagagtcccaaactcgaattcgaagatacaacaacgaatctgaaaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39185319 |
agcaatagcagcaagtctcagagacccaacagaacgatagaaaccccaatcctaagagacccaaactcgaattcaaagatacaacaacgaatctgaaaca |
39185418 |
T |
 |
| Q |
200 |
aaaacacaaaccacaggttct |
220 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
39185419 |
aaaacacaaaacacaggttct |
39185439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University