View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12199_high_6 (Length: 345)
Name: NF12199_high_6
Description: NF12199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12199_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 199 - 331
Target Start/End: Original strand, 14469605 - 14469737
Alignment:
| Q |
199 |
tctagcattccaaatccgagattgatctgaagataaaaaccaaacataaatgccatggagcagaccacgatccagatccggagagtggagaggctgacgg |
298 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14469605 |
tctagcattccgaatccgagattgatctggagataaaaaccgaacataaatgccatggagcagaccacgatccagatccggagagtggagaggctgacgg |
14469704 |
T |
|
| Q |
299 |
cattgatgctgatgaatagcttgagtgcacagg |
331 |
Q |
| |
|
| |||| |||||||| |||||||||||| |||| |
|
|
| T |
14469705 |
ccttgacgctgatgagtagcttgagtgcccagg |
14469737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University