View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12199_high_7 (Length: 338)
Name: NF12199_high_7
Description: NF12199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12199_high_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 20 - 338
Target Start/End: Complemental strand, 25524723 - 25524407
Alignment:
| Q |
20 |
ttcctgtcttctataaacaaagaggcaatttattttatccggcatgggcatggacattgtccacatggattcttcaatttccttattccattgttgaatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25524723 |
ttcctgtcttctataaacaaagaggcaatttattttatccggcatgggcatggacactgtccacatggattcttcaatttccttattccattgttgaatc |
25524624 |
T |
 |
| Q |
120 |
tgttgcatggactggtgtcgtgtactacattattggatttgctcctgcacctgggaggtattttactttacattcatatactgtcttatgacnnnnnnnn |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25524623 |
tgttgcgtggactggtgtcgtgtactacattattggatttgctcctgcacctgggaggtattttactttacattcatatactctcttatgac-ttttttt |
25524525 |
T |
 |
| Q |
220 |
ctgtcttcttttaaaactcatacatactcttggcattccggttaatatttcaggttcttccgctacatgcttttattgcttatggtgcaccaaatggcat |
319 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25524524 |
ctgtcttctttt-aaactaatacatactcttggcattccggttaatatttcaggttcttccgctacatgcttttattgcttatggtgcaccaaatggcat |
25524426 |
T |
 |
| Q |
320 |
taggtctctttcggctcac |
338 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25524425 |
taggtctctttcggctcac |
25524407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University