View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12200_low_16 (Length: 273)
Name: NF12200_low_16
Description: NF12200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12200_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 27991954 - 27991717
Alignment:
| Q |
13 |
gagatgggtcgcaacggagctgctgcagagattggagatggatcgcaatgaaactgtttttggtttgatttggattttggagtgaaatgaatc-atttga |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27991954 |
gagatgggtagcaacggagctgctgcagagattggagatggatcgcaatgaaactgtttttggtttgatttggattttggagtgaaatgaatcaatttga |
27991855 |
T |
|
| Q |
112 |
ttaagttttaatgttagggttcaatcactggcttttgttcaatttgggttatgttcagttttggnnnnnnnc-nnnnnnngaggttaggttaataagtgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
27991854 |
ttaagttttaatgttagggttcaatcactggcttttgttcaatttgagttaagttcagttttggtttttttcaaaaaaaaaaggttaggttaataagtgc |
27991755 |
T |
|
| Q |
211 |
tcctttaagcaaggatcggatcaaaacttttacatacc |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27991754 |
tcctttaagcaaggatcggatcaaagcttttacatacc |
27991717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 69 - 175
Target Start/End: Complemental strand, 24004222 - 24004115
Alignment:
| Q |
69 |
tttttggtttgatttggattttggagtgaaatgaatc-atttgattaagttttaatgttagggttcaatcactggcttttgttcaatttgggttatgttc |
167 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||| ||| |||| |
|
|
| T |
24004222 |
ttttttgtttgatttagattttggagtgaaatgaatttatttgattaagttttaatgttagggttcaatcactgttttttgttcaacttggattaagttc |
24004123 |
T |
|
| Q |
168 |
agttttgg |
175 |
Q |
| |
|
|||||||| |
|
|
| T |
24004122 |
agttttgg |
24004115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University