View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12200_low_17 (Length: 241)
Name: NF12200_low_17
Description: NF12200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12200_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 30177686 - 30177908
Alignment:
| Q |
19 |
gtgctcgctccggaaaatgaggccttaattgaaaggtgcaccacatcaaaccaaaaaccaaaatgatatttggtctgaagccaatacttgatggtgtcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30177686 |
gtgctcgctccggaaaatgaggccttaattgaaaggtgcaccacatcaaaccaaaaaccaaaatgatatttggtctgaagcccatacttgatggtgtcac |
30177785 |
T |
 |
| Q |
119 |
aactcacaacttcaaacaaacagagaaaaggtgttaggaccggcacacaagttattgggcttgtgacccgttcatgcaccatgagactaagggcccaaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30177786 |
aactcacaacttcaaacaaacagagaaaaggtgttaggaccggcacacaagttattgagcttgtgacccgttcatgcaccatgagactaagggcccaaag |
30177885 |
T |
 |
| Q |
219 |
atatggagggtttatactcgcag |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30177886 |
atatggagggtttatactcgcag |
30177908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University