View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12203_high_16 (Length: 250)
Name: NF12203_high_16
Description: NF12203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12203_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 53173855 - 53173773
Alignment:
| Q |
18 |
atgaatgaataatgtaaaagaccaaaacttgttgaaccatgattaaccagttcaatttaatttgatcaaactgtaatataact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
53173855 |
atgaatgaataatgtaaaagaccaaaacttgttgaaccatgattaaccaattcaatttaatttgatcaaactgtaatacaact |
53173773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 53173699 - 53173639
Alignment:
| Q |
174 |
cttgtagaacttctgtgtgaccaattcaatataactaaaatcaaaccagttgacgaacatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53173699 |
cttgtagaacttctgtgtgaccaattcaatataactaaaatcaaaccagttgacgaacatg |
53173639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University