View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12203_low_11 (Length: 360)
Name: NF12203_low_11
Description: NF12203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12203_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 54279270 - 54279075
Alignment:
| Q |
1 |
tggatttaaattagcatctctgctacaaaacacagatgtcgtgtcatggtatcatcttgagaaagaactggctccatacaacatttcccttttgaaatat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
54279270 |
tggatttaaattagcgtctctgctacaaaacacagatgtcgtgtcatggtatcatcatgagaaagaattcgctccatacaacatttcccttttgaaatat |
54279171 |
T |
|
| Q |
101 |
tcaaatttaagtttcccggagtgtttcttcaaaaacaaagtttcccagaatgtcttcttttcatttagaaaatcacaatactctatgagcattctg |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54279170 |
tcaaatttaagtttccaggagtgtttcttcaaaaacaaagtttcccagaatgtcttcttttcatttagaaaatcacaatactctatgagcattctg |
54279075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 257 - 345
Target Start/End: Complemental strand, 54279014 - 54278926
Alignment:
| Q |
257 |
gagaagggtaaacagggttttgtaaaaatgtaggtggtgggaaaaccgcatgagggtagagaaaagcacaatcaacttgaaatcacagc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54279014 |
gagaagggtaaacagggttttgtaaaaatgtaggtggtgggaaaaccgcatgagggtagagaaaagcacaatcaacttgaaatcacagc |
54278926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University