View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12203_low_14 (Length: 313)
Name: NF12203_low_14
Description: NF12203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12203_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 15 - 295
Target Start/End: Original strand, 44058704 - 44058983
Alignment:
| Q |
15 |
ctgtgtgatgtgccaaaatgtaactgagtcagattggcgtctctttcatgaatggcagttgtgagcaatgcacgtgacagaatcagttacaataataggt |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44058704 |
ctgtgtgatgtgccaaaatgtaactgattcagattggcgtctctttcatgaatggcagttgtgagcaatgcacgtgacagaatcagttacaataataggt |
44058803 |
T |
|
| Q |
115 |
ctggacagtcactgcctgagggctacttgaaatgcaatttagaggcggcagtcttagcagacgtgtttgcgggtttcagctggcattctaatgatatcta |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44058804 |
ttggacag-cactgcctgagggctacttgaaatgcaatttagaggcggcagtcttagcagacgtgtttgcgggtttcagctggcattctaatgatatcta |
44058902 |
T |
|
| Q |
215 |
tctcgctcgaaatggtgcaagttgcaacattgttatgacttcagcagaggcctgaggaattagagaatcgtactgagtatg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44058903 |
tctcgctcgaaatggtgcaagttgcaacattgttatgacttcagcagaggcctgaggaattagagaatcgtactgagtatg |
44058983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University