View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12204_high_7 (Length: 279)
Name: NF12204_high_7
Description: NF12204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12204_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 29856636 - 29856686
Alignment:
| Q |
19 |
acattttcatcttgctgcatcaccctcgcatagaattatgttggtgaaaac |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29856636 |
acattttcatcttgctgcatcaccctcgcatagaattatgttggtgaaaac |
29856686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 41311499 - 41311444
Alignment:
| Q |
19 |
acattttcatcttgctgcatcaccctcgcatagaattatgttggtgaaaacttatc |
74 |
Q |
| |
|
||||||||| |||||||||||| || | |||||||| |||| |||||||||||||| |
|
|
| T |
41311499 |
acattttcaacttgctgcatcatccacacatagaatcatgtcggtgaaaacttatc |
41311444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University