View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12205_low_14 (Length: 280)
Name: NF12205_low_14
Description: NF12205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12205_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 528200 - 528474
Alignment:
| Q |
1 |
cagcttgaaaggtttgtgggcgagacgccgacagactctcgtgccaatataacatcatccaacaatagcactcatgttgcttcacgctctactgattttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
528200 |
cagcttgaaaggtttgtgggcgagacgccgacagactctcgtgccaatataacatcatccaacaatagcactcatgttgcttcacactctacggattttg |
528299 |
T |
|
| Q |
101 |
gagttgccggtggtaacaatggagcaagccaccgcatggtagaagagggtttaagcgttggtggctcctcagtgcagattaagggtcttaatgagaagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528300 |
gagttgccggtggtaacaatggagcaagccaccgcatggtaggagagggtttaagcgttggtggctcctcagtgcagattaagggtcttaatgagaagca |
528399 |
T |
|
| Q |
201 |
aaagattgtagagcttgctgttgttggaatggatgaactgaccaaattggctaggacatatggaccccctctttg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528400 |
aaagattgtagagcttgctgttgttggaatggatgaactgaccaaattggctaggacatatggaccccctctttg |
528474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University