View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12205_low_20 (Length: 233)
Name: NF12205_low_20
Description: NF12205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12205_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 127
Target Start/End: Complemental strand, 45124974 - 45124871
Alignment:
| Q |
24 |
tactaattaattcctctacttttaattatagctagagaatcagtttgagatattgtggtccatgtaatgccttggccaaacaataagttgttgtcatata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45124974 |
tactaattaattcctctacttttaattacagctagagaatcagtttgagatattgtggtccatgtaatgccttggccaaacaataagttgttgtcatata |
45124875 |
T |
|
| Q |
124 |
tata |
127 |
Q |
| |
|
|||| |
|
|
| T |
45124874 |
tata |
45124871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University