View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12205_low_7 (Length: 338)
Name: NF12205_low_7
Description: NF12205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12205_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 323
Target Start/End: Complemental strand, 39660725 - 39660416
Alignment:
| Q |
13 |
ctgtgtctacacacacatacatataannnnnnnnnnnnccggagcatgcctattataatacatttgctctatatgcagctgattgtttgcttttttcagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39660725 |
ctgtgtctacacacacatacatataattttttccttttccggagcatgcctattataatgcatttgctctatatgcagctgattgtttgcttttttcagg |
39660626 |
T |
 |
| Q |
113 |
taggcatttataaatatgtttagacctctgttgaacagtagggaaaatgctcaatctgaatagatcagaaataatttttagtaggaatgcatgtaatggg |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39660625 |
taggcatttataaatatgtttagacctatgttgaacattagggaaaatgctcaatccgaatagatcagaaataatttttagtaggaatgcatgtaatggg |
39660526 |
T |
 |
| Q |
213 |
accaaaatcatgagcattatatgtgtgctcttgaatttgggtcaaaggctaatatctgtgatttatatcaaagatagagtttagaatagaatcatttcat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39660525 |
accaaaatcatgagcattatatgtgtgctcttgaatttgggtc-aaggctaatatctgtgacttatatcaaagatagagtttagaatagaatcatttcat |
39660427 |
T |
 |
| Q |
313 |
gtagtggaaag |
323 |
Q |
| |
|
||||||||||| |
|
|
| T |
39660426 |
gtagtggaaag |
39660416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University