View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12207_low_5 (Length: 232)
Name: NF12207_low_5
Description: NF12207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12207_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 49685441 - 49685641
Alignment:
| Q |
17 |
agagaacaatcgggatgttttcacaaaccctgaaaacaattgtacagaaaatcaccaaacagtaagataaccatgttggtgatgaatactgggtgtttag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49685441 |
agagaacaatcgggatgttttcacaaaccctgaaaacaattgtacagaaaatcaccaaacagtaagataaccatgttggtgatgaatactgggtgtttag |
49685540 |
T |
|
| Q |
117 |
caacaaaatgattaaaaaggtttcaaggactcttgatttacataccggcaaagatcacggtgccaggtagggacattcttgtatgtcagtcgggctgtaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49685541 |
caacaaaatgattaaaaaggtttcaaggactcttgatttacataccggcaaagatcacggtgccaggtagggacattcttgtatgtcagtcgggctgtaa |
49685640 |
T |
|
| Q |
217 |
c |
217 |
Q |
| |
|
| |
|
|
| T |
49685641 |
c |
49685641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 72 - 217
Target Start/End: Original strand, 49695698 - 49695841
Alignment:
| Q |
72 |
caaacagtaagataaccatgttggtgatgaatactgggtgtttagcaacaaaatgattaaaaaggtttcaaggactcttgatttacataccggcaaagat |
171 |
Q |
| |
|
|||| |||||||||| || |||||| |||||| ||||| |||| |||||||| ||||||||||||| ||||||| | |||||||||||||||||| | |
|
|
| T |
49695698 |
caaaaagtaagataaacaacttggtggtgaatattgggtctttaacaacaaaacaattaaaaaggtttgaaggact--taatttacataccggcaaaggt |
49695795 |
T |
|
| Q |
172 |
cacggtgccaggtagggacattcttgtatgtcagtcgggctgtaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
49695796 |
cacggtgccaggtagggacattcttgtaagtcagtcgggcagtaac |
49695841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 130 - 217
Target Start/End: Original strand, 49690908 - 49690993
Alignment:
| Q |
130 |
aaaaaggtttcaaggactcttgatttacataccggcaaagatcacggtgccaggtagggacattcttgtatgtcagtcgggctgtaac |
217 |
Q |
| |
|
|||||||||||||||||| |||||| |||| ||||||||||||||||||||||| ||||| |||||||| || ||||| ||||| |
|
|
| T |
49690908 |
aaaaaggtttcaaggactgc--atttactaaccgacaaagatcacggtgccaggtaggaacatttttgtatgttagacgggcagtaac |
49690993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University