View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12208_high_8 (Length: 233)
Name: NF12208_high_8
Description: NF12208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12208_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 10650877 - 10650680
Alignment:
| Q |
14 |
cagagagaaagggaaaaagggctttatttaggacaaaaatatttgggtacaaaacttgtacttttaaaagggaaatgtttcctttatataggggactata |
113 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| ||||||||||| ||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
10650877 |
cagagagaaagggcaaaaggggtttatttagtacaaaaatattggggtacaaaacttgtacgtttaaaagggaagtatttcctttatataggggtctata |
10650778 |
T |
 |
| Q |
114 |
gacaacaaagttatgttgtgtgccaaattctgtttaatattttatt--atttgatataaaacaatggtaacttaattatgtatatgatgtcccacaaaca |
211 |
Q |
| |
|
|||||||||||| || ||| ||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10650777 |
gacaacaaagtt-----gtttgctaaattgtgtttaatattttattttattcgatataaaacaatggtaacttaattatgtatatgatgtcccacaaaca |
10650683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University