View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12208_low_3 (Length: 378)
Name: NF12208_low_3
Description: NF12208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12208_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 359
Target Start/End: Original strand, 3471819 - 3472177
Alignment:
| Q |
1 |
atactgctcttgcgaattttccgggacggttttggattggaactagataggaaccggcggacgcttcccattcgggttggtgacagctatctgcacagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3471819 |
atactgctcttgcgaattttccgggacggttttggattggaaccagataggaaccggcggacgcttcccattcgggttggtgacagctatctgcacagct |
3471918 |
T |
 |
| Q |
101 |
ggtggagtggaacactggcacaccgacttgtgtgcaggcgtaacactccaccatgctgattactgggttgtcgtctgctatgacggcaactccagggtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3471919 |
ggtggagtggaacactggcacaccgacttgtgtgcaggcgtaacactccaccatgctgatgactgggttgtcgtctgctatgacggcaactccagggtca |
3472018 |
T |
 |
| Q |
201 |
tcactgctgtcaccaacgttgttgattgtgttgctaggattccttcccaagaattttccaccaatccacctatataacataaacatacatcaaaattttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472019 |
tcactgctgtcaccaacgttgttgattgtgttgctaggattccttcccaagaattttccaccaatccacctatataacataaacatacatcaaaattttg |
3472118 |
T |
 |
| Q |
301 |
aaaaaactcaactatttgatatcaaaatcatcataaaattagcatcaatacactattac |
359 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3472119 |
aaaaaactcaactatttgacatcaaaatcatcataaaattagcatcaatacacaattac |
3472177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University