View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12211_high_4 (Length: 277)
Name: NF12211_high_4
Description: NF12211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12211_high_4 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 29606155 - 29605879
Alignment:
| Q |
1 |
acgacaataggtagttttttagcagcggttggtgtagtagaagttggtgaagctgccgttggcaacttggaaggtgcagcagggattatagttggtaatt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606155 |
acgacaataggtggttttttagcagcggatggtgtactagaagttggtgaagctgccgttggcaacttggaaggtgcagcagggattatagttggtaatt |
29606056 |
T |
 |
| Q |
101 |
tggatggtgctgctgctgagatcgtggtcgagggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606055 |
tggatggtgctgctgctgagatcgtggtcgagggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctac |
29605956 |
T |
 |
| Q |
201 |
aataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtgcagctg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29605955 |
aataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtgcagctg |
29605879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 172 - 277
Target Start/End: Complemental strand, 29605777 - 29605672
Alignment:
| Q |
172 |
tttgtactactagcaggagttgctgctacaataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtg |
271 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||| |||||||| || |||| ||| || ||| | |||||||| || ||||||||||||||||||| |
|
|
| T |
29605777 |
tttgtattactagcaggagttgcagccacaataggctgttgtttgtataatggcagtgttgatggttccgatggatttgtggttggcaacttcgatggtg |
29605678 |
T |
 |
| Q |
272 |
cagctg |
277 |
Q |
| |
|
|||||| |
|
|
| T |
29605677 |
cagctg |
29605672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 29605862 - 29605777
Alignment:
| Q |
132 |
gggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctacaataggcttttgtttgt |
217 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||| ||| |||||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29605862 |
gggtttgttagaagtaggagaagttgctgcaggttgtttgtttgtattactagcaggagttgctgccacaataggctgttgtttgt |
29605777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University