View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12211_low_11 (Length: 208)
Name: NF12211_low_11
Description: NF12211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12211_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 75 - 195
Target Start/End: Original strand, 23332595 - 23332715
Alignment:
| Q |
75 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
175 |
ttcgactcctgatctctctgc |
195 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgc |
23332715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 4 - 80
Target Start/End: Original strand, 23322297 - 23322373
Alignment:
| Q |
4 |
gcagaacctgtgttttttatagacaattcagactgacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322297 |
gcagaacctgtgttttttatagacaattcagactgacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 4 - 80
Target Start/End: Original strand, 23332464 - 23332540
Alignment:
| Q |
4 |
gcagaacctgtgttttttatagacaattcagactgacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332464 |
gcagaacctgtgttttttatagacaattcagactgacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University