View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12211_low_8 (Length: 277)

Name: NF12211_low_8
Description: NF12211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12211_low_8
NF12211_low_8
[»] chr8 (3 HSPs)
chr8 (1-277)||(29605879-29606155)
chr8 (172-277)||(29605672-29605777)
chr8 (132-217)||(29605777-29605862)


Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 29606155 - 29605879
Alignment:
1 acgacaataggtagttttttagcagcggttggtgtagtagaagttggtgaagctgccgttggcaacttggaaggtgcagcagggattatagttggtaatt 100  Q
    |||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29606155 acgacaataggtggttttttagcagcggatggtgtactagaagttggtgaagctgccgttggcaacttggaaggtgcagcagggattatagttggtaatt 29606056  T
101 tggatggtgctgctgctgagatcgtggtcgagggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29606055 tggatggtgctgctgctgagatcgtggtcgagggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctac 29605956  T
201 aataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtgcagctg 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29605955 aataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtgcagctg 29605879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 172 - 277
Target Start/End: Complemental strand, 29605777 - 29605672
Alignment:
172 tttgtactactagcaggagttgctgctacaataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtg 271  Q
    |||||| |||||||||||||||| || |||||||||| |||||||| ||  |||| ||| || ||| | |||||||| || |||||||||||||||||||    
29605777 tttgtattactagcaggagttgcagccacaataggctgttgtttgtataatggcagtgttgatggttccgatggatttgtggttggcaacttcgatggtg 29605678  T
272 cagctg 277  Q
    ||||||    
29605677 cagctg 29605672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 29605862 - 29605777
Alignment:
132 gggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctacaataggcttttgtttgt 217  Q
    ||||||||||||| ||||||| |||||||| ||| |||  |||||| ||||||||||||||||||| |||||||||| ||||||||    
29605862 gggtttgttagaagtaggagaagttgctgcaggttgtttgtttgtattactagcaggagttgctgccacaataggctgttgtttgt 29605777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University