View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12213_low_5 (Length: 240)
Name: NF12213_low_5
Description: NF12213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12213_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 19342834 - 19343047
Alignment:
| Q |
18 |
aaaatctgcttctgatgttgtacaagaatatgatgagttttgtaaggccactaatgagcaactatctttggatcaaatgaaagagattcttgaagctaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
19342834 |
aaaatctgcttctgatgttgtacaagaatatgatgagttttgtaaggccactaatgagcaactatctttggagcaaatgaaagagattcttgaggctaat |
19342933 |
T |
 |
| Q |
118 |
ggtcttgattcctctggctctgatcttgaaattacacgaagttggttagtgatagaaataataaatagctcctaaagaatatgaaatttgtcactttggt |
217 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19342934 |
gatcttgattcatctggctctgatcttgaaattacacgaagatggttagtgatagaaataataaatagctcctaaagaatatgaaatttgtcactttagt |
19343033 |
T |
 |
| Q |
218 |
catgttcacaggtt |
231 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
19343034 |
catgttcataggtt |
19343047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University