View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12214_high_11 (Length: 375)
Name: NF12214_high_11
Description: NF12214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12214_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 15 - 355
Target Start/End: Original strand, 10441021 - 10441361
Alignment:
| Q |
15 |
cagagaggagaagaaaagatggtcaacaagtacctccaagtgacaaggtttatgaatgcattcttttccgaggaagtgacattaaggtaactatattatc |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441021 |
cagaggggagaagaaaagatggtcaacaagtacctccaagtgacaaggtttatgaatgcattcttttccgaggaagtgacattaaggtaactatattatc |
10441120 |
T |
|
| Q |
115 |
attatttaactgatttgcagtctattgttaataagagaaataagcatgtgatgaaatatttctgatttattgctcagaagcatctcaccctgtgtggggg |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441121 |
attatttaactgatttgcagactattgttaataagagaaataagcatgtgatgaaatatttctgatttattgctcagaagcatctcaccctgtgtggggg |
10441220 |
T |
|
| Q |
215 |
agttaataaggcttggctgatgttgttgtattgctgtgatatatcttagttttgaggttttaaaatatttttataatatatgaatgatttctgattgagg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441221 |
agttaataaggcttggctgatgttgttgtattgctgtgatatatcttagttttgaggttttaaaatatttttataatatatgaatgatttctgattgagg |
10441320 |
T |
|
| Q |
315 |
ccttnnnnnnntttgttgtcccttgttcgtttatgcaactt |
355 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10441321 |
ccttaaaaaaatttgttgtcctttgttcgtttatgcaactt |
10441361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University