View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12214_low_26 (Length: 249)
Name: NF12214_low_26
Description: NF12214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12214_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 40 - 233
Target Start/End: Complemental strand, 39043620 - 39043427
Alignment:
| Q |
40 |
ttcatcgtaagaattttgtgcaaaaatatcattattttgattttgatttgtctgattttaagtttaatctgttatttacatgttgagtgaaccttcactt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39043620 |
ttcatcgtaagaattttgtgcaaaaatatcattattttgattttgatttgtctgattttaagtttaatctgttatttacatgttgagtgaaccttcactt |
39043521 |
T |
 |
| Q |
140 |
tcacatgccataagtatatgtatgcatgaaagcatggttgttaatttgttattgtagtattgttaatattgggtttattttatatatgttggca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39043520 |
tcacatgccataagtatatgtatgcatgaaagcatggttgttaatttgttattgtagtattgttaatattgggtttattttatatatgttggca |
39043427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University