View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12215_low_4 (Length: 284)
Name: NF12215_low_4
Description: NF12215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12215_low_4 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 32574360 - 32574645
Alignment:
| Q |
1 |
ctttaggcacttgtaatgatgaagataaagaagataccaatttggaagcactgaacgttgttcctacttcctactctgattttggttctgaagaagcact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32574360 |
ctttaggcacttgtaatgatgaaggtaaagaagataccaatttggaagcactgaacgttgttcctacttcctactctgattttggttctgaagaagcact |
32574459 |
T |
 |
| Q |
101 |
atacactgaacgcaaagattcttcgaagtctcaacttgagtccttcatattaattatgcaatttaatatgaattttccaccgtcatcttgcagtttttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32574460 |
atacactgaacgcaaagattcttcgaagtctcaacttgagtccttcatattaattatgcaatttaatatgaattttccaccgtcatcttgcagtttttgt |
32574559 |
T |
 |
| Q |
201 |
tccctggcttctagatcaacagtgatgttgattattgtgtctagtgtgaatac--ggattttgtaagcagcaagtttctgggcctg |
284 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
32574560 |
tccctggcttctagatcaacagtgatattgattattgtgtctagcgtgaatacttggattttgtaagcagcaagtttctggacctg |
32574645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 7892260 - 7892309
Alignment:
| Q |
229 |
tgattattgtgtctagtgtgaatac--ggattttgtaagcagcaagtttc |
276 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7892260 |
tgattattgtgtctagtgtgaatacttggattttgtaagcagaaagtttc |
7892309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 133
Target Start/End: Original strand, 32607218 - 32607258
Alignment:
| Q |
93 |
gaagcactatacactgaacgcaaagattcttcgaagtctca |
133 |
Q |
| |
|
|||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32607218 |
gaagaactatacactgagcacaaagattcttcgaagtctca |
32607258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University