View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12216_low_4 (Length: 244)
Name: NF12216_low_4
Description: NF12216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12216_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 35 - 233
Target Start/End: Original strand, 35631423 - 35631619
Alignment:
| Q |
35 |
ttattagattaaattaataaaaagttctccaaacctgtcactgtttcaagtaaacttggaggagccatatctacaaaacaacaacaaaacaatgaagtga |
134 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
35631423 |
ttattagattaaattaataaaaagtt-tccaaacctgtcgctgtttcaagtaaacttggaggagccatatctacaaaattcaaagaaaacaatgaagtga |
35631521 |
T |
|
| Q |
135 |
ataattgagatgatgaagatgaatatataaggtgcgatgaatggaagtgacacgtggcatagcttcgttttggacacaaaaacagagacaagtcacagg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35631522 |
ataattgagatgatgaagatgaatatataaggtgcaatgaatggaagtgacacgtggcatagcttcgttttggacac-aaaacagagacaagtcacagg |
35631619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University