View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12219_high_3 (Length: 216)
Name: NF12219_high_3
Description: NF12219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12219_high_3 |
 | |
|
| [»] scaffold0164 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 43558244 - 43558058
Alignment:
| Q |
15 |
cagagagactcaaactagtccaagctgatttaatggaagaaaatagcttcgacaatgcgatcatgggatgcaaaggtgtctttcacattgcctctccagt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43558244 |
cagaaagactcaaactagtccaagctgatttaatggaagaaaatagcttcgacaatgcgatcatgggatgcaaaggtgtctttcacattgcctctccagt |
43558145 |
T |
|
| Q |
115 |
actcaatcatatatcaaatgatcctaaggtttgatatttcatttatatta----attattcataggtatctctatgtcacaacctat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43558144 |
actcaatcatatatcaaatgatcctaaggtttgatatttcatttatattaattaattattcatagatatctctatgtcacaacctat |
43558058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 23694 - 23511
Alignment:
| Q |
15 |
cagagagactcaaactagtccaagctgatttaatggaagaaaatagcttcgacaatgcgatcatgggatgcaaaggtgtctttcacattgcctctccagt |
114 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23694 |
cagaaagactcgaactagtccaagctgatttaatggaacaaaatagcttcgacaaagcgatcatgggatgcaaagctgtctttcacattgcctctccagt |
23595 |
T |
|
| Q |
115 |
actcaatcatatatcaaatgatcctaaggtttgatatttcatttatattaattattcataggtatctctatgtcacaacctataagct |
202 |
Q |
| |
|
|| ||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23594 |
acccaatcatatatcaaatggtcctaaggtgtgatatttcatttat----attattcataggtatctctatgtcacaacctataagct |
23511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University