View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12220_high_7 (Length: 293)
Name: NF12220_high_7
Description: NF12220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12220_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 114 - 183
Target Start/End: Complemental strand, 3790533 - 3790464
Alignment:
| Q |
114 |
ggtagaaagagagcaccaaagcccagatagttatatcaactttaatgttattagaatcattttgtattac |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3790533 |
ggtagaaagagagcaccaaagcccagatagttatatcaactttaatattattagaataattttgtattac |
3790464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University