View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12220_high_8 (Length: 288)
Name: NF12220_high_8
Description: NF12220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12220_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 22 - 280
Target Start/End: Complemental strand, 35666171 - 35665913
Alignment:
| Q |
22 |
ttgtaaagaggaactcatcaaagtgcactgatttttactttgacttagatttgagatggatttacgatgaagtaggtttttcagtttgagagatattgga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35666171 |
ttgtaaagaggaactcatcaaagtgcactgatttttactttgacttagatttgagatggatttacgatgaagtaggtttttcagtttgagagatattgga |
35666072 |
T |
 |
| Q |
122 |
gaattggtagggatggaatgagtagtagagaaattggtgcgagtgtttgtacctctaaggagaaaagcagcttcatcgtaagctcgagcagcttcctcag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35666071 |
gaattggtagggatggaatgagtagtagagaaattggtacgagtatttgtacctctaaggagaaaagcagcttcatcgtaagctcgagcagcttcctcag |
35665972 |
T |
 |
| Q |
222 |
cagttttataggtaccaagccacatcctaatgttctttgatgtgtcttttatctctgct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35665971 |
cagttttataggtaccaagccacatcctaatgttctttgatgtgtcttttatctctgct |
35665913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University