View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12220_low_1 (Length: 554)
Name: NF12220_low_1
Description: NF12220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12220_low_1 |
 | |
|
| [»] scaffold0020 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0020 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 268 - 543
Target Start/End: Original strand, 7561 - 7836
Alignment:
| Q |
268 |
gacgcaattttaccttccaaattggagatcaggtgctcctccgactacgaccttaccggcaaaccaccgtcaaccgccgcacctctcagaagttatccaa |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7561 |
gacgcaattttaccttccaaattggagatcaggtgctcctccgactacaaccttaccggcaaaccaccgtcaaccgccgcacctctcagaagttatccaa |
7660 |
T |
|
| Q |
368 |
gcgtttctttggaccgttcaagataactgaacgcgttggatctgttgcttaccgccttgaccttccaccggaatctcgtatacacccagtggtccacatc |
467 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7661 |
gtgtttctttggaccgttcaagataactgaacgcgttggatctgttgcataccgccttgaccttccaccggaatctcgtatacacccagtggtccacatc |
7760 |
T |
|
| Q |
468 |
tccatgttacgaccatactacggtggcgaagaccttcctcttcctccaccagatgactcaacaacggcacaggttc |
543 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7761 |
tccatgttacgaccatactacggtggcgaagaccttcctcttcctccaccagatgactcaacaacggcacaggttc |
7836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020; HSP #2
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 7310 - 7528
Alignment:
| Q |
16 |
cagacactggtacaagttcctgcatctagcagaattctggcacaactccacagtgcattcagcaatcaagatggctccgtttgaagccctttatggtaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7310 |
cagacactggtacaagttcctgcatctagcagaattctggcacaactccacagtgcattcagcaatcaagatggctccgtttgaagccctttatggtaga |
7409 |
T |
|
| Q |
116 |
cagccaccaaccattccagactatgttcctggtaacaccaccatcataaccttagacgaatcattgaaaaagagacaggaaattctcaaccgcctcaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7410 |
cagccaccaaccattccagactatgttcctggtaacaccaccatcacaaccttagacgaatcattgaaaaacagacaggaaattctcaaccgcctcaaag |
7509 |
T |
|
| Q |
216 |
caaatcttcacagcgcaag |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7510 |
caaatcttcacagcgcaag |
7528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University