View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12220_low_12 (Length: 293)

Name: NF12220_low_12
Description: NF12220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12220_low_12
NF12220_low_12
[»] chr7 (1 HSPs)
chr7 (114-183)||(3790464-3790533)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 114 - 183
Target Start/End: Complemental strand, 3790533 - 3790464
Alignment:
114 ggtagaaagagagcaccaaagcccagatagttatatcaactttaatgttattagaatcattttgtattac 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||    
3790533 ggtagaaagagagcaccaaagcccagatagttatatcaactttaatattattagaataattttgtattac 3790464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University