View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12220_low_6 (Length: 408)
Name: NF12220_low_6
Description: NF12220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12220_low_6 |
 | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 333690 - 333493
Alignment:
| Q |
13 |
aacctgtgcaaggattcgaatttttgcaagtttttcaacaaagtcgatgccaacttccctttgtaaaacatctttgagaagatttccaagcaacttacag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333690 |
aacctgtgcaaggattcgaatttttgcaagtttttcaacaaagtcgatgccaacttccctttgtaaaacatctttgagaagatttccaagcaacttacag |
333591 |
T |
|
| Q |
113 |
tcatcgtcgaagccttggaaggacatttcctcggcaatgtcatcagtagtgtccgtcatgtttactcgaacacaggaattgatcgatcgataaggaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
333590 |
tcatcgtcgaagccttggaaggacatttcctcggcaatgtcatcagtagtgtccgtcatgtttactcgaacacagaaattgatcgatcgataaggaac |
333493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 290 - 398
Target Start/End: Complemental strand, 333413 - 333305
Alignment:
| Q |
290 |
tgtagcatatatgcatgttttttgagttactattattacaatcaatatataacaaacaagtggcacccaaggcgggaacgaagggatcgttatgaaattg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333413 |
tgtagcatatatgcatgttttttgagttattattattacaatcaatatataacaaacaagtggcacccaaggcgggaacgaagggatcgttatgaaattg |
333314 |
T |
|
| Q |
390 |
tctctgctc |
398 |
Q |
| |
|
|| |||||| |
|
|
| T |
333313 |
tcactgctc |
333305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 86 - 171
Target Start/End: Complemental strand, 42169015 - 42168930
Alignment:
| Q |
86 |
ttgagaagatttccaagcaacttacagtcatcgtcgaagccttggaaggacatttcctcggcaatgtcatcagtagtgtccgtcat |
171 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||| || |||| ||||| || ||||| || ||||| ||||| |||||||| ||||| |
|
|
| T |
42169015 |
ttgagaagattaccaagcaacctacaatcatcatcaaagctctggaacgagatttcttcagcaatatcatctgtagtgtctgtcat |
42168930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University