View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12221_low_14 (Length: 366)
Name: NF12221_low_14
Description: NF12221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12221_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 19 - 357
Target Start/End: Original strand, 47275096 - 47275434
Alignment:
| Q |
19 |
ggggttttcaaaggcgaattgcgttggttcttgcacatctttgccctgcagatgatcaaagaagaatttttattgaacaccatggtaaatgcatcttcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47275096 |
ggggttttcaaaggcgaattgcgttggttcttgcacatctttgccctgcagatgatcaaagaagaatttttattgaacaccatggtaaatgcatcttcgt |
47275195 |
T |
|
| Q |
119 |
aaaatgctttcatgggtttgattactgttgtttcatgctgtacaaattcctttttgtacttgttacatttcaaagttaagcatctttccatataggtctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47275196 |
aaaatgctttcatgggtttgattactgttgtttcatgctgtacaaattcctttttgtacttgttacatttcaaagttaagcatttttccatataggtctt |
47275295 |
T |
|
| Q |
219 |
gagttgcttatcagtcttctcagctcatccagctccaaacagcaacttgatggtgctgtggctttatgcaagttggccaataaagcctcagccctgtctc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47275296 |
gagttgcttatcagtcttctcagctcatccagctccaaacagcaacttgatggtgctgtggctttatgcaagttggccaataaagcctcagccctatctc |
47275395 |
T |
|
| Q |
319 |
ctgtagacgctgctcctccttctccaacaccacaggttc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47275396 |
ctgtagacgctgctcctccttctccaacaccacaggttc |
47275434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 258 - 356
Target Start/End: Complemental strand, 678981 - 678883
Alignment:
| Q |
258 |
cagcaacttgatggtgctgtggctttatgcaagttggccaataaagcctcagccctgtctcctgtagacgctgctcctccttctccaacaccacaggtt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||| | |||||||||||||| ||||||||||| || |||||||| |||||| |
|
|
| T |
678981 |
cagcaacttgatggtgctgtggctttattcaagttggccaacaaagctatgactctgtctcctgtagatgctgctcctccatccccaacacctcaggtt |
678883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University