View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12221_low_16 (Length: 341)
Name: NF12221_low_16
Description: NF12221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12221_low_16 |
 |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 38723284 - 38723399
Alignment:
| Q |
1 |
actcaggttaagctccgtctcgga-cctagtggggttaggagtaaagcatcccgaggttggcgcatctcgttgggcgtggagaagcattgggaatctcca |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38723284 |
actcaggttaagctccgtctcggaacctagtggggttaggagtaaagcatcccgaggttggcgcatctcgttgtgcgtggagaagcattgggaatctcca |
38723383 |
T |
 |
| Q |
100 |
tttctttcttcggagc |
115 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38723384 |
tttctttcttcggagc |
38723399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 41815 - 41771
Alignment:
| Q |
214 |
aggaaccgtctaccagttggcaagctagacatcaagtaagtggct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41815 |
aggaaccgtctaccagttggcaagctagacatcaagtaagtggct |
41771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 63 - 134
Target Start/End: Complemental strand, 25550362 - 25550291
Alignment:
| Q |
63 |
catctcgttgggcgtggagaagcattgggaatctccatttctttcttcggagccgtttcttttcccgtcccc |
134 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||| ||||||||||| || |||||| || |||||||||||| |
|
|
| T |
25550362 |
catcttgttgggtgtggagaagcattaggaatttccatttcttttctcacagccgtatcatttcccgtcccc |
25550291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University