View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12221_low_18 (Length: 323)
Name: NF12221_low_18
Description: NF12221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12221_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 2223115 - 2223414
Alignment:
| Q |
1 |
ggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgtgataggctgcacttgttgttggcggaggaagtgaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2223115 |
ggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgtgataggttgcacttgttgttggcggaggaagtgaagg |
2223214 |
T |
 |
| Q |
101 |
agggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaaaatggatagtgaaattggagtcggtggaagttgtggtgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223215 |
agggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaagatggatagtgaaattggagtcggtggaagttgtggtgatga |
2223314 |
T |
 |
| Q |
201 |
ggttgatgggaataccgtgggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgctttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223315 |
ggttgatgggaataccgtgggttcgacggcggctgtggtggtggtggggaaggaggagattgtagtggcgaattgtggtgactcaagggcggtgctttgt |
2223414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University