View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12221_low_23 (Length: 248)
Name: NF12221_low_23
Description: NF12221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12221_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 13 - 241
Target Start/End: Original strand, 3434519 - 3434745
Alignment:
| Q |
13 |
gtgctctaattaataaaaatgtgtatatatcatctatatatgatttgtgcattcagattgggaactaacccaagcaaagctaggagtaaaatttgcatga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3434519 |
gtgctctaattaataaaaatgtgtatatatc---tatatatgattagtgcattcagattgggaactaacccaagcaaagctaggagtaaaatttgcatga |
3434615 |
T |
 |
| Q |
113 |
aaactgaaaatgtaatctttggttgatccttcctg-nnnnnnnttaaaccatatgttagcatttatttgtaaagcaattcaaaaactcaaaatatgctga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3434616 |
aaactgaaaatgtaatctttggttgatccttcctgaaaaaaaattgaaccatatgttagcatttatttgtaaagcaattcaaaaactcaaaatatgctga |
3434715 |
T |
 |
| Q |
212 |
atttcttatatacatacaatcaaaaatcca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3434716 |
atttcttatatacatacaatcaaaaatcca |
3434745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 147
Target Start/End: Original strand, 3375547 - 3375622
Alignment:
| Q |
72 |
gggaactaacccaagcaaagctaggagtaaaatttgcatgaaaactgaaaatgtaatctttggttgatccttcctg |
147 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
3375547 |
gggagctaacccaagcaaagctaggaggaaaatttgaatgaaaatgggaaatgtaatctttggttgagacttcctg |
3375622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University