View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12222_high_4 (Length: 263)
Name: NF12222_high_4
Description: NF12222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12222_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 188 - 250
Target Start/End: Complemental strand, 44495160 - 44495097
Alignment:
| Q |
188 |
gggtgtgaggtcaggttgtggtgg-cctaattagaggagatcaatgagaatacatgttgtttct |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44495160 |
gggtgtgaggtcaggttgtggtgggcctaattagaggagatcaatgagaatgcatgttgtttct |
44495097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University