View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12222_high_7 (Length: 238)

Name: NF12222_high_7
Description: NF12222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12222_high_7
NF12222_high_7
[»] chr5 (1 HSPs)
chr5 (160-225)||(16272316-16272381)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 160 - 225
Target Start/End: Original strand, 16272316 - 16272381
Alignment:
160 tatcttgcaatcaacctcaaagatgacttgttgatgttccatgtccctcacccacttgagagcaca 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16272316 tatcttgcaatcaacctcaaagatgacttgttgatgttccatgtccctcacccacttgagagcaca 16272381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University