View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12223_low_9 (Length: 286)

Name: NF12223_low_9
Description: NF12223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12223_low_9
NF12223_low_9
[»] chr8 (2 HSPs)
chr8 (5-207)||(27694535-27694738)
chr8 (230-276)||(27694488-27694534)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 27694738 - 27694535
Alignment:
5 cactttgtaactctttaatgaatatttttaaaagaatttttgattaaatgattgaatcagagtaatatgttaaaatatgagattaaattgcaattttgat 104  Q
    ||||||||||||||||||| |||||||||||||   |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||    
27694738 cactttgtaactctttaatcaatatttttaaaattttttttgattaaatgattgaatc-gagtaatatgttaaaatatgagattaaattgcaattttcat 27694640  T
105 taatcggttgattagattgataaagagttgactcatatcccacaattgataaagagctcaacttccgctaata--attgagacattgttgatagacaaca 202  Q
    |||||| ||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||  |||||||||||||||||||||||||    
27694639 taatcgattgattagattgataaagagttgactcatattccacaattgataaaaagttcaacttccgctaatatcattgagacattgttgatagacaaca 27694540  T
203 aatac 207  Q
    |||||    
27694539 aatac 27694535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 230 - 276
Target Start/End: Complemental strand, 27694534 - 27694488
Alignment:
230 cttgagatctatatatctcgggacattgtgtccttttcctttctctg 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
27694534 cttgagatctatatatctcgggacattgtgtccttttcctttctctg 27694488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University