View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12223_low_9 (Length: 286)
Name: NF12223_low_9
Description: NF12223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12223_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 27694738 - 27694535
Alignment:
| Q |
5 |
cactttgtaactctttaatgaatatttttaaaagaatttttgattaaatgattgaatcagagtaatatgttaaaatatgagattaaattgcaattttgat |
104 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27694738 |
cactttgtaactctttaatcaatatttttaaaattttttttgattaaatgattgaatc-gagtaatatgttaaaatatgagattaaattgcaattttcat |
27694640 |
T |
 |
| Q |
105 |
taatcggttgattagattgataaagagttgactcatatcccacaattgataaagagctcaacttccgctaata--attgagacattgttgatagacaaca |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27694639 |
taatcgattgattagattgataaagagttgactcatattccacaattgataaaaagttcaacttccgctaatatcattgagacattgttgatagacaaca |
27694540 |
T |
 |
| Q |
203 |
aatac |
207 |
Q |
| |
|
||||| |
|
|
| T |
27694539 |
aatac |
27694535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 230 - 276
Target Start/End: Complemental strand, 27694534 - 27694488
Alignment:
| Q |
230 |
cttgagatctatatatctcgggacattgtgtccttttcctttctctg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694534 |
cttgagatctatatatctcgggacattgtgtccttttcctttctctg |
27694488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University