View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12224_high_5 (Length: 282)
Name: NF12224_high_5
Description: NF12224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12224_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 21932841 - 21932684
Alignment:
| Q |
18 |
gaaatgagagtatcttttcctccatctcttaacaaattgttaatggttatggtgtctttagctaagcaatggtttaaagaagtgaaaaatattaagcata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
21932841 |
gaaatgagagtatcttttcctccatctcttatcaaattgttaatggttatggtatcttttgctaaacaatggttaaaagaagtgaaaaatattaagcata |
21932742 |
T |
 |
| Q |
118 |
agcagaagatagacaacatatgactagaagagtagttaaggataattatctttctggt |
175 |
Q |
| |
|
| ||||||||||||||||| ||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
21932741 |
aacagaagatagacaacatgtgattagaagagtaattaaggattattatctttctggt |
21932684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 196 - 279
Target Start/End: Complemental strand, 21932684 - 21932608
Alignment:
| Q |
196 |
ttagcatataacaaagaaaatggttagagttcttcttatgttaggtgttagtcgcacaattttaggaggggtctctgcttctcc |
279 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||| |||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
21932684 |
ttagcatataataaagaaaatggttagagttcatcttatg-------ttagtcacacaattttaggaggggtttctgtttctcc |
21932608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University