View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12225_low_2 (Length: 292)
Name: NF12225_low_2
Description: NF12225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12225_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 14 - 285
Target Start/End: Complemental strand, 6631529 - 6631258
Alignment:
| Q |
14 |
ctgtgaagaaagaaaagaataagtataacgtcccacaattatgttgcaagagatatctcatgccaattcaatagacattaacggccttttccttattgtc |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6631529 |
ctgtgaagaaagaaaagaataagtattacgtcccacaattatgttgcaagagatatctcatgccaattcaatagacattaacggccttttccttattgtc |
6631430 |
T |
|
| Q |
114 |
aaactctgttctcaatttgagaagggaacttgtaggatttctagataagatgaagtttcctcttgaatctctgatgctgctagtactcggaacgtcagaa |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6631429 |
aaactctgtactcaatttgagaagggaacttgtaggatttctagataagatgaagtttcctcttgaatctctgatgctgctagtactcggaacgtcagaa |
6631330 |
T |
|
| Q |
214 |
ttcataacgattctgcatgattgtggatcatctgatcccatgtcaacgccataatagactaggtggtctgtg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6631329 |
ttcataacgattctgcatgattgtggatcatctgatcccatgtcaacgccataatagactaggtggtctgtg |
6631258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University