View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12225_low_3 (Length: 284)
Name: NF12225_low_3
Description: NF12225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12225_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 183 - 279
Target Start/End: Complemental strand, 34923569 - 34923473
Alignment:
| Q |
183 |
cccccttaatttatctttttcttttaaatggtaaatgttagcattcttagttctttactttgaaaatggggattgaactcttaaccttcttctcact |
279 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34923569 |
cccccttaatttatcattttcttttaaatggtaaatgttagcattcttagttttttactttgaaaatggggattgaactcttaaccttcttatcact |
34923473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 34923708 - 34923658
Alignment:
| Q |
6 |
aagaactaacttgcattgatatacttgagtaaagagatcaaactcaacctc |
56 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34923708 |
aagaactaacttgcattaatatacttgagtaaagagatcaaactcaacctc |
34923658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University