View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12227_high_2 (Length: 308)
Name: NF12227_high_2
Description: NF12227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12227_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 45565780 - 45565492
Alignment:
| Q |
1 |
acgtggttgctagctcctattttatgaattctgcgtgcaaagagatgatgttgggcgaatggatgagaatgtggggtttgcgaattctctaacagatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45565780 |
acgtggttgctagctcctattttatgaattctgcgtgcaaagagatgatgttcggtgaatggatgagaatgtggggtttgcgaattctgtaacagatcaa |
45565681 |
T |
 |
| Q |
101 |
agtttttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45565680 |
agtttttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaaca |
45565581 |
T |
 |
| Q |
201 |
aactatgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565580 |
aactatgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg |
45565492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 218
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
| Q |
186 |
ccccattgtgaaacaaactatgagaacgattgg |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
45286940 |
ccccattgtgaaacaaactacgagaacgattgg |
45286972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University